【Single-Cell Sequencing 】Demultiplexing of the 10X Genomics CMO part
CMO stands for Cell Multiplexing Oligo, which was a feature barcode from 10X and designed to distinguish different types of samples before doing GEM. (For example： one is treated， another is normal. The following explains how to manually demultiplex the reads after sequencing and separate reads by CMO barcodes.
CMO Format
The first 15 bp (0-14) of CMO's R2 were feature barcodes designed to distinguish the sequences from different samples. There were 12 types which name were CMO301-CMO312 and you could download the specific sequences from this link :
https://support.10xgenomics.com/csv/default_cmo_ref.csv
According to the 10X documentation:
https://assets.ctfassets.net/an68im79xiti/6G2iPa3N9L3ZtsSCJlR3yO/
dd9e4749ebb7f7894
f193db1ddd148bb/CG000388
_ChromiumNextGEMSingle
Cell3-v3.1_CellMultiplexing_RevB.pdf
The chart on page 75 explained that it had 22 static base pairs after it (Capture Sequence 2) as flowing. For exampleGCTCACCTATTAGCGGCTAAGG（looking from right to left)
After that was the final 12-base pair UMI and 16-base pair 10X cell Barcode ( from 37 to 64), also looking from right to left.
- 0-14 : CMO feature barcodes(N15)
- 15-36 : Capture Sequence 2 (GCTCACCTATTAGCGGCTAAGG)
- 37-48 : UMI(N12)
- 49-64 : 10X barcodes(N16)
After understanding the format of CMO, we can to do demultiplexing by ourselves.
A passionate bioinformatician focuses on the next generation of medical science and biotechnology.
English 
Chinese